Evolution Can’t Explain Everything
“Evolution can’t explain everything” –> This post is a direct continuation of the blog post, “Does God Really Exist?” Part 3. So, if you haven’t read that yet, please do.—–
As a speaker, I always do an experiment using Legos to prove a point that dead things can’t move or create anything… including themselves. I tell my audiences that I once built a large three part Lego house. Using my memory and intelligence, I could probably remake it again, or come pretty close. However, if there is no God, then there is no one to re-build the house and we have to take me out of the equation. At this point, in front of the whole audience, I dump all the Legos out of a large bag to try and see if it will all magically assemble themselves.
I have been doing this for over 10 years, and not even two Legos have ever come together randomly. I could wait my whole life, and a Lego house will not build itself. It never could or would. (Now, keep in mind too that if there is no God, and I represent God in the analogy, then there would be no one to even dump out the Legos. They would just sit there lifelessly in that bag until they disintegrate. They can’t move themselves, and thus, they can’t create). Therefore, if we want a house, a intelligent being, in this case a human, would have to build it. Likewise, a dead universe, or many dead universes cannot create either. If a dead Lego house can’t make itself because it’s dead and can’t move, then neither can a dead universe which has many, many, many, many, more parts involved. Thus, there must be a master Builder, a Designer. It’s pretty obvious that this the evidence points to God!
Why Evolution Can’t Explain Everything
Atheists like Richard Dawkins claim that evolution can explain everything (which even atheists find a ridiculous statement). Dawkins asserts that anything super complex can become this way through evolution. Now, one can observe this with living things on earth, but two questions naturally follow that blow this line of thinking out of the water.
1. How did we get life from non-life? How did life arise spontaneously from dead, non-living matter?
2. While we see evolution in living things, dead things don’t evolve or work the same way. Though Dawkins tends to treat dead things like living things, he is wrong to do so. Dead things are dead. So, one wonders how the universe, or anything dead entity, evolved from other dead things? The answer: They don’t. These are just two reasons why evolution can’t explain everything. Evolution can’t either of these questions.
In my last post, I showed the complexity and intelligibility of the universe. This can also be observed in DNA. Science tells us that the tiny, microscopic DNA strand has more information in it than anything in the known universe. We cannot duplicate anything like the DNA strand and no supercomputer on earth can compete with the amount of information DNA holds. Wow! What is the information for? For instructing proteins and amino acids on how to build life. There is a point to this! But first, here is an example of what the DNA looks like: GCTTAATAGCCCTAGCTAGGGAGATTTCTATGAGGGGTG
ATTTCCCGGATATATTTGGGGCGGCTAAAAAATAGCCCTAGCTAGGGAGATTTCTAT
CCTAGCTAGGGAGATTTCTATGAGGGGGGGGGCCTAGCTACCCACCCAGGGGTGAG
ATTTCCCGGATATATTTGGGGCGGCTTAATATTTTTAAACTAGGGAGATTTCTATGAG
CCTAGCTAGGGAGATTTCTATGAGGGGGGGGGCCTAGCTAGGGAGATTTCTATGAG
ACACACACTGAACCCCCTAGCTAGGGAGATTTCTATGAGCCTAGCTAGGGAGATTTC
ATTTCCCGGATATATTTGGGAGAACAACAATAGGGGTGAGATTTCTATGAGGGGTGA
Now imagine in your mind a whole book of this code. Go ahead, imagine it! All those tens of thousands of letters have to align together perfectly for life to form. Did they just self-assemble one day, randomly, accidentally? To show that impossibility of this feat, I like to do another experiment with Scrabble Letters at my retreats.
To illustrate how dead things can’t move or form themselves together, I dump out a bunch of Scrabble Letters from their bag and try to spell one sentence in Shakespeare’s Hamlet: To be or not to be that is the question. As an intelligent human being, I could take out the letters from the bag and line them up one at a time, intelligently. However, if there’s no God, then there would be nothing to line up the letters intelligently. Thus, I start dumping the letters out and see if they create the sentence in Hamlet by themselves. (Side note: If there is no God, no living being, there wouldn’t even be anyone to dump out the dead letters, and therefore they would lay there lifeless until they disintegrate).
Would anyone reading this be surprised if I told you that it has never worked? In fact, in over 10 years of doing this, I have never had even one letter fall in the right place. Ever! And, that one sentence is a only 20 letters.
Now consider that you need 150-200 pages of this DNA code, tens of thousands of letters to randomly come together somehow by themselves for life to form. Picture how many letters that is in your mind. Type it out on a computer or scroll down through 150+ pages of text. No matter what language it’s in, can all those letters assemble themselves in that language randomly? Go through these pages, and you will see how super, mega-complex it all is. And, this is exactly what’s needed in order to create a mere single celled organism, an un-evolved ameba. Many critics, like Richard Dawkins claim that complexity can be explained through evolution, but what we have here is undescribably complex DNA … and in the first un-evolved creature. Nothing preceded it. This first life form, the simplest single-celled organism would need this mega-complexity to exist. Where did it come from? How? Spontaneously? A random occurrence of chance? And, we won’t even mention the necessity of super complex proteins, amino acids, and nucleic acids, etc.
(As a side note, this is why some atheists claim that there must be a higher alien intelligent life that did this. They are getting closer). Now consider that to make one human being, it would take three billion characters of ATCG to make up one human life. That is hundreds of books with hundreds of pages stacked from floor to ceiling all the way across your living room floor. Picture that in your mind. Talk about complex!
And, to top it all off, adding to the problem of impossibility, there was not enough time for all of this to happen spontaneously based on how old the earth is as far as we can tell. Benjamin Wiker sums up the whole problem from a materialist point of view, “You see, for Darwinian evolution to get going, you’ve got to have something already alive that can replicate and pass on desirable traits. But nothing prior to the cell can do that, and even the simplest cell is itself wondrously complex. Imagine someone thinking that he can drive a car while he’s also trying to build it from scratch.” (Emphasis added)
Wiker now makes the key point, “When the simplest cells appeared on the earth some 3.8 billion years ago – literally, as soon as the conditions of the cooling Earth would allow them to exist. … A bit less than two billion years passed before cells complex enough for significant biology, eukaroytes, arrived on the scene. And then relatively little happened for about another billion and a half years. So far on the biological timeline, we’ve already “used up” four billion of the Earth’s 4.8 billion years – almost 90% – with very little to show for it. … Now, here’s the rub: if it takes three billion years to get from the simplest cell to a cell that is fit for complex biology, how long – given the biological distance we still have to climb – should it take to get to, say, an iguana, a turtle, a swan, on ox, or a human being by the same blind process of random variation and natural selection? We’ve only got 10% of our time left. If we had another 500 billion years, things might be different… but we don’t.” (In other words, if there is no God, there was not near enough time for life to develop naturally, randomly, materialistically, blindly and slowly. The atheist and materialist view doesn’t work.
While many atheists sincerely seek God but struggle with it, many atheists, agnostics, and skeptics fail to look at all the evidence for different reasons. In effect, they cover their eyes with their hands and then shout, “There’s no proof!” “I can’t see any proof.”
As we have said over and over, there is a lot of proof. They may seek to convince themselves otherwise, but they know deep down that there is something deeper in this life, a deeper meaning, a deeper truth. The evidence for God is absolutely there. His fingerprints and intelligibility are seen all over His creation.
